What is Golden Gate Assembly?
Golden Gate assembly, also known as Golden Gate cloning, is a one-pot, one-step cloning procedure created by Carola Engler and colleagues in 2008.The method takes advantage of Type IIS restriction enzymes (e.g. BsaI), which cleave DNA outside their recognition sequences. The result is an ordered assembly of a vector and one or more DNA fragments.
► Golden Gate Assembly videos on SnapGene Academy
How Does Golden Gate Assembly Work?
Golden Gate assembly can be split into two distinct steps that occur within the same reaction:
- Type IIS restriction enzyme digestion
- DNA ligation
Step 1: Type IIS Restriction Enzyme Digestion
The destination vector and insert fragment(s) both contain compatible Type IIS restriction sites.
Golden gate single insert cloning
Unlike conventional restriction cloning, which utilizes Type IIP restriction enzymes that recognize a palindromic sequence and cleaves within the recognition site, Golden Gate assembly uses Type IIS restriction enzymes.
Type IIS restriction enzymes have various unique properties that make Golden Gate assembly possible.
- Non-palindromic recognition site: The recognition site is non-palindromic. In general, sites range from 4 to 7 nucleotides
- Shifted cleavage: Cleavage is performed outside the recognition site. The shifted cleavage site allows for sequences to be digested for cloning without disruption of important sequences
- Variable sticky ends: Cleavage on each strand is staggered, resulting in unique overhangs (1 to 5 nucleotides) associated with a single recognition site. For example, with a 4-base overhang, up to 256 different overhang sequences are possible, which enables multiple DNA fragments to be assembled in the same reaction. The unique four base pair overhangs are often referred to as Fusion Sites.
Type IIP v. Type IIS restriction enzymes
Type IIS restriction enzymes exhibit great diversity in the length of their recognition site, the offset of the cleavage site from the recognition site, and the nature of the overhang; see this list for a complete picture of this diversity.
► Learn more about restriction cloning
Step 2: DNA Ligation
Once the destination vector and DNA insert(s) are digested, their complementary overhangs are joined together by DNA ligase to create an ordered assembly. The process is often denoted as “scarless” or “seamless” since undesired nucleotides are not added between the DNA fragments and the restriction sites are eliminated in the final construct.
Multi-insert golden gate cloning
Components of Golden Gate Assembly
Golden Gate assembly works by mixing the following components into a single reaction tube:
- Destination vector
- DNA insert(s) (e.g. amplicon or pre-cloned)
- Type IIS restriction enzyme (e.g. BsaI)
- T4 DNA ligase
- Reaction buffer
Gateway Reactions are processed in a thermocycler. Assemblies of more than 3 fragments will cycle through reaction temperatures to achieve optimal cloning outcomes.
Destination Vector
Golden Gate destination vectors are available either through commercial sites (e.g. New England Biolabs), individual labs, or Addgene.
Alternatively, you can adapt your own vector to be Golden Gate ready. The vector should contain two Type IIS recognition sites (e.g. BsaI) that flank the desired insert region and a screening marker (e.g. lacZ). The enzyme recognition sites must be oriented with an “outward” orientation so that after digestion the insert and the enzyme’s recognition sites are removed from the vector.
It’s critical to remove undesired Type IIS cleavage sites from your destination vector; this is known as domestication. If your vector does contain unwanted cleavage sites within the backbone, you will need to remove these before starting Golden Gate assembly. Unwanted cleavage sites can be easily removed with site-directed mutagenesis.
► Watch a video on site-directed mutagenesis
Golden gate destination vector
DNA Insert(s)
Any double-stranded piece of DNA can be used as the source of insert for Golden Gate Assembly, including both PCR product and plasmid DNA.
A fragment of interest is adapted for Golden Gate Assembly by the addition of Type IIS restriction sites. Recognition sites must be oriented with an “inward orientation” so that after cleavage the Type IIS recognition site is removed from your fragment.
Golden gate DNA insert
For amplicon preparation, PCR primers are designed that contain flanking bases, the Type IIS recognition site and an overhang sequence. After amplification, the PCR product can either be cloned into a Golden Gate Destination vector or into a Golden Gate Entry Vector, such as pGGA, for sequence verification and re-use in multiple experiments.
- Forward Primer: 5’ tt GGTCTC a GGAG attcacacccaaaacattc
- Reverse Primer: 5’ tt GGTCTC g ATGG atcaactgaattgaaaagag
As with the destination vector preparation, it’s also important that your DNA insert(s) do not contain extraneous Type IIS restriction sites. Unwanted cleavage sites can be removed with site-directed mutagenesis. If the Type IIS recognition site is in a coding sequence, the mutation(s) you introduce must be silent.
Golden Gate Assembly-Based Kits
There are various pre-designed kits available that utilize Golden Gate technology, such as transcription activator-like effector nucleases (TALENs), Golden GATEway and modular cloning (MoClo).
TALENs
Thomas Cermak and colleagues first described the design and assembly of custom TALEN constructs in 2011. TALENs are fusions of transcription activator-like (TAL) effectors to a Type IIS restriction endonuclease (e.g. FokI), which is achieved through Golden Gate assembly. TAL effectors contain a customizable array of amino acid repeats that bind to desired regions of DNA. Once bound to DNA, the fused nuclease creates a targeted double-strand break.An alternative to CRISPR, TALENs are useful genome engineering tools that can be used to create gene knockouts or introduce specific DNA sequence modifications.
Golden GATEway Cloning
Golden GATEway cloning kits combine the efficiency of Golden Gate assembly with the sequence-independent approach of Multisite Gateway™ cloning.
As described by Stephan Kirchmaier and colleagues in PLOS One, fragments of interest are cloned into one of eight Golden Gate entry vectors. The elements in the GG-entry vectors are then assembled in one of three Golden Gate destination vectors. The Golden Gate destination clones play a dual role and function as entry clones for three-part Multisite Gateway cloning.
► Learn more about Gateway™ cloning
MoClo
The MoClo system is a hierarchical approach introduced by Ernst Weber and colleagues that enables the creation of multigene constructs through a series of three Golden Gate assembly reactions.
MoClo kits generally contain three sets of cloning vectors (Level 0, 1, and 2) that allow users to recombine basic modules (e.g. promoters, coding sequences, and terminators) into transcription units, which are later joined to form multigene constructs. The MoClo system can be readily automated for applications such as gene stacking and metabolic engineering.
Tips and Additional Resources
Double-check the orientation and order of your fragments
When performing Golden Gate assembly, it’s very important you take the time beforehand to plan the orientation and order of your DNA fragments.
It’s recommended to map the Type IIS restriction sites that you will be using and carefully annotate the fusion sequence associated with each site. When using primers to introduce Type IIS restriction sites to amplicons or pre-cloned plasmids, ensure the recognition sites face inwards (i.e. towards your DNA insert). As you process your cloning strategy, you will need to be sure that the selected fusion sites will ultimately assemble your fragments of interest in the correct order.
Consider different Type IIS restriction enzymes
If your vector backbone or insert fragments contain unwanted Type IIS restriction sites, then also consider using an alternative enzyme. It’s more likely to discover internal sites with Type IIS enzymes that have a shorter recognition site (e.g. MnII, 4 bases), compared with those with a longer recognition site (e.g. BaeI, 7 bases).
Commercially available Golden Gate assembly components
Learn More
► Simulating Cloning in SnapGene
A video series on how to simulate a range of cloning techniques in SnapGene
FAQs
What are Golden Gate assembly methods? ›
Golden Gate Cloning or Golden Gate assembly is a molecular cloning method that allows a researcher to simultaneously and directionally assemble multiple DNA fragments into a single piece using Type IIS restriction enzymes and T4 DNA ligase. This assembly is performed in vitro.
How long does Golden Gate Assembly take? ›Golden Gate cloning is one of the easiest cloning methods in terms of hands-on time, as digestion and ligation can be done in one 30-minute reaction. The destination vector and entry vector(s) are placed in a single tube containing the Type IIS enzyme and ligase.
What are the steps of Golden Gate cloning? ›The amplified product is cloned in a recipient vector using Golden Gate cloning. The cloning steps consist of defining the part type, design primers containing BsaI restriction sites at the ends of the fragments, removing sites from internal sequences, and cloning the amplified fragments in a vector.
What enzymes are used in Golden Gate Assembly? ›Golden Gate assembly utilizes a Type IIS restriction enzyme (REase), which cleaves outside of its non-palindromic recognition sequence and T4 DNA Ligase in a simultaneous, single-tube reaction.
Why is it called Golden Gate? ›In 1775 the San Carlos, navigated by Juan Manuel de Ayala, was the first European ship to sail through the strait. The name Golden Gate was given in 1846 by Captain John C. Frémont in analogy to the Golden Horn of the Bosporus (Turkey) when he visualized rich cargoes from the Orient flowing through the strait.
What does Golden Gate mean? ›The strait that connects San Francisco Bay to the Pacific Ocean.
How much is the Golden Gate fee? ›| Number of Axles (see chart) | FasTrak Toll | License Plate Account & One-Time Payment |
|---|---|---|
| 2 Axles/ Motorcycles | $8.40 | $8.80 |
| 3 Axles | $25.20 | $26.40 |
| 4 Axles | $33.60 | $35.20 |
| 5 Axles | $42.00 | $44.00 |
Given the nature of type IIS restriction enzymes, Golden Gate reactions are easily and scarlessly performed due to the flexibility of choosing the Golden Gate linkers.
What temperature should a Golden Gate Assembly be? ›Regardless of the number of inserts, if it is more convenient, any Golden Gate Assembly can be done overnight with 30 cycles of 37°C, 5 min → 16°C, 10 min; i.e., there is no downside for longer protocols being used. Inserts should be screened for the presence of internal BsaI sites.
What are the 5 steps to clone an animal? ›- the nucleus is removed from an unfertilised egg cell.
- the nucleus from an adult body cell, such as a skin cell, is inserted into the egg cell.
- an electric shock stimulates the egg cell to divide to form an embryo.
- these embryo cells contain the same genetic information as the adult skin cell.
How many steps are there to cross the Golden Gate Bridge? ›
It's about 6,040 steps across and 1.7 miles, so if you walk there and back, you're already getting in more than all the recommended steps for the day (plus some totally great photos for Instagram too).
What are the three 3 types of human cloning? ›- Gene cloning, which creates copies of genes or segments of DNA.
- Reproductive cloning, which creates copies of whole animals.
- Therapeutic cloning, which creates embryonic stem cells.
Golden Gate assembly, also known as Golden Gate cloning, is a one-pot, one-step cloning procedure created by Carola Engler and colleagues in 2008.
Which 2 enzymes are needed in genetic modification? ›Genetic engineering became possible with the discovery of mainly two types of enzymes: the cutting enzymes called restriction endonucleases and the joining enzymes called ligases.
Which enzyme is commonly used in genetic engineering? ›“DNA ligase enzyme is used in genetic engineering” is broadly used for the joining of DNA strands. The reaction of ligation or joining is regulated by different key factors such as concentration, ph, temperature, and others.
What is buried under the Golden Gate Bridge? ›Underneath the Golden Gate Bridge lies the wreck of the City of Chester, a steamboat that sank on August 22, 1890 at 10 a.m. The boat was impaled on the steamer Oceanic, arriving from Asia, and sunk in six minutes. It traveled to the seafloor and settled in, still upright.
Why is Golden Gate so special? ›Acclaimed as one of the world's most beautiful bridges, there are many different elements to the Golden Gate Bridge that make it unique. With its tremendous towers, sweeping cables, and great span, the Bridge is a sensory beauty and engineering wonder featuring color, sound and light.
How deep is the water beneath the Golden Gate Bridge? ›Want to swim over the deepest part of the bay? Maybe you've already done it and had no idea - you'll find the deepest water in our Golden Gate Bridge race just under the bridge at over 370 feet.
Why is the Golden Gate not gold? ›The name has nothing to do with its color
While it's obvious today that the name isn't related to its color, many tourists assume that it was once gold. In fact, according to the website, “The term Golden Gate refers to the Golden Gate Strait which is the entrance to the San Francisco Bay from the Pacific Ocean.
In Jewish tradition, the Messiah will enter Jerusalem through this gate, coming from the Mount of Olives. Christians and Muslims generally believe that this was the gate through which Jesus entered Jerusalem.
Why is Golden Gate Bridge not gold color? ›
The Golden Gate Bridge has always been painted orange vermilion, deemed "International Orange." Rejecting carbon black and steel gray, Consulting Architect Irving Morrow selected the distinctive orange color because it blends well with the span's natural setting as it is a warm color consistent with the warm colors of ...
What happens if you don't pay Golden Gate Bridge toll? ›A: An unpaid Toll Invoice or any unpaid portion of a Toll Invoice will result in a Toll Violation notice which attaches a $25 penalty for each toll transaction associated with the unpaid invoice. If the first violation notice goes unpaid, a second violation notice will be issued, with increased penalties.
What is free at Golden Gate Park? ›How much does it cost to enter Golden Gate Park? During the day, Golden Gate Park is free. Special attractions, such as the museums require fees (including Japanese Tea Garden and Conservatory of Flowers).
Can you walk across the Golden Gate Bridge for free? ›Yes, you can! The other great news is that the pedestrian walkway is open every day of the year and free for all visitors. Walking across this incredible gem is a highlight of many trips to SF. The Golden Gate Bridge is a colorful International Orange and sits over a narrow straight above the San Francisco Bay.
What are the limitations of Golden Gate Assembly? ›Perhaps the most significant limitation of the Golden Gate method is that it is less sequence-independent than SLIC/Gibson/CPEC/SLiCE, in the sense that, like BioBrick assembly, the selected type IIs recognition site (e.g. BsaI) should be absent from the internal portions of all of the DNA fragments to be assembled.
How many fragments golden cloning can carry? ›One of these methods, Golden Gate cloning, allows assembling up to nine fragments at a time in a recipient plasmid.
Did the Golden Gate Bridge flatten? ›The middle of the bridge sagged seven feet under the unprecedented weight, causing the iconic arch to flatten. Officials quickly closed the bridge, preventing an additional 600,000 people from crossing. Engineers afterward said that the bridge, which was built to bend, was never in danger of collapsing.
How cold is the water underneath the Golden Gate Bridge? ›The water in this location never warms up to comfortable values. Average annual water temperature on the coast in Golden Gate Bridge is 54°F, by the seasons: in winter 53°F, in spring 53°F, in summer 54°F, in autumn 56°F.
How cold does it get on the Golden Gate Bridge? ›San Francisco is unique in that summertime temperatures in the Bay Area can be over 100° F and yet when a cold fog blows in through the Golden Gate the temperature can drop as low as 50° F down on the piers.
Are Golden Retrievers built for cold weather? ›Many golden retrievers love the snow and they don't mind the freezing temperatures. I know my goldens will lie out in the snow and love making snow angels. When temperatures get extremely frigid, this can be very dangerous for the dogs. Golden retrievers have thick hair coats that can help keep them warm when outside.
Has a human been cloned? ›
1 No one has ever cloned a human being, though scientists have cloned animals other than Dolly, including dogs, pigs, cows, horses and cats. Part of the reason is that cloning can introduce profound genetic errors, which can result in early and painful death.
Are we eating cloned meat? ›Yes. Food from cattle, swine, and goat clones is as safe to eat as food from any other cattle, swine, or goat. But it's important to remember that the primary purpose of clones is for breeding, not eating.
How many attempts does it take to clone an animal? ›In order to get one clone to work, scientists have to make many, many (sometimes 200 to 300) attempts, most of which fail. Also, once a single animal is cloned, in order for it to be useful in conservation biology it needs to reproduce.
What is difference between classic and integrated Golden Gate? ›Integrated capture supports more data and storage types as compared to classic capture. Integrated capture is the only mode to supports capture from a multitenant container database.
How is Golden Gate Assembly different from Gibson Assembly? ›The Golden Gate method relies on the presence of restriction sites within a particular sequence to be cloned, while Gibson Assembly does not rely on the presence of restriction sites within a particular sequence to be cloned. Thus, this is the key difference between Golden Gate and Gibson Assembly.
What is Golden Gate Microservices architecture? ›Oracle GoldenGate Microservices Architecture is a new microservices architecture that provides REST-enabled services as part of the Oracle GoldenGate environment. The REST-enabled services provide remote configuration, administration, and monitoring through HTML5 web pages, command line, and APIs.
How do I know if my extract is classic or integrated? ›- INFO EXTRACT <EXT_NAME> Using the above command, you can clearly see if the extract is Integrated or Classic. ...
- Integrated Extract - INEXT. GGSCI (OGG1.localdomain) 27> info extract inext. ...
- Classic Extract - EXT1. GGSCI (OGG1.localdomain) 29> info extract ext1.
One of the difference between Classic Replicat and Integrated Replicat is, like Classic Replicat process, Integrated Replicat does not have a Checkpoint Table. In the above output, you can clearly see there is no checkpoint table details.
What are the different types of Golden Gate replication? ›Ans: Goldengate supports replication of DML and DDL transactions. DML replication is supported in both unidirectional and bidirectional mode. DDL replication is supported in unidirectional mode only.